Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone H010H03
Clone ID H010H03
Vector FlipROSAbgeo0
Project ggtc

Sequence tag H010H03
Sequence
AAGAGAGANNNGAACAGATGAAAGAGGGTGAAGAAACTGAAGGCTCAGAGGAAGAGGACAGAGAAAATGACAAGGCTGAA
GAAACACCAAATGAATCAGTTCTTGAAAAAAAG
Sequence Type mRNA
Unitrap ID UNI10703

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 4: 116278289..116283040 83
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000028693 (Nasp) NM_016777 nuclear autoantigenic sperm protein (histone-binding) Gene [Source:MGI (curated);Acc:Nasp-001]

 
Come back to gene ENSMUSG00000028693


For any suggestions or comments, please send an email to unitrap@crg.es