Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone H009E01
Clone ID H009E01
Vector FlipROSAbgeo0
Project ggtc

Sequence tag H009E01
Sequence
CGCTCTTTTCTCGGGACGGTGGAGGCCGTGCAGCGTCGCCCATACTCCGAGCAAAGAACTGTGCCAGAGGCAGTCGAGGT
TAGTGAGGCNNGCGAGGCAGACACTTTGCTGTGTTCAAATCCAAGTCAAG
Sequence Type mRNA
Unitrap ID UNI10491

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr X: 98625031..98625891 67
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000031311 (Nono) NM_023144 non-POU-domain-containing, octamer binding protein Gene [Source:MGI (curated);Acc:Nono-001]


SPLK-Sequence tag 3SH009E01
Sequence
AATCCTAACTGCTGATCTCTGTAGTTAGGGTTTGGTAAGTTTATTTCTGCTAAATTATATTATTGCATTTAACATAGGAA
CATTTCTTTCATGCTTGGGACTTGCTGTGAATACAGAGGTAATTTAGATTCTTTGGGCAGTGCTAACCTTCCTTGGTAAA
TGGAAACTTATGGAGAAGACTACATGGAAGGGAAAGATTTTGAAATCTGTCACCATGGGGATTTTTATTCAAAAACAAAT
AAAATAAATT
Sequence Type genomic DNA
Unitrap ID UNI6843

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr X: 98626426..98626675 242
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000031311 (Nono) NM_023144 non-POU-domain-containing, octamer binding protein Gene [Source:MGI (curated);Acc:Nono-001]

 
Come back to gene ENSMUSG00000031311


For any suggestions or comments, please send an email to unitrap@crg.es