Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone DD0520
Clone ID DD0520
Vector pGT1lxrT2
Project sanger

Sequence tag DD0520
Sequence
CTTCCCCTCCCTTCTTTTTCTCCTCCTTTATCCCCTACATTTCTCGTATCGTCTGGTTCCATGAAGCTTTCTTCCGCTCC
GGTCCTCTCCTCTATCTCTCCATCTCATGGGTCTTTATTCCTTTCTGTTTCCCTCTTAGCCTTTCATTATCTGAGCAAAG
CTTGCAAAAGAGAAAGCGGAACAAGAGAAGCTGGAACGCCAGAAGAAGAAGAAGCAACTCATTGACATAAACAAAGAGGG
TGATGAGACGGGAGTGATGGATAATCTTCTGGAAGCCCTACAGTCAGGTGCAGCATTCAGAGACCGCAGAAAGCGAATTC
CAAGAAATCCAG
Sequence Type mRNA
Unitrap ID UNI1272

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr X: 126824442..126862597 98
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000034480 (Diap2) NM_017398 diaphanous homolog 2 (Drosophila) Gene [Source:MGI (curated);Acc:Diap2-001]

 
Come back to gene ENSMUSG00000034480


For any suggestions or comments, please send an email to unitrap@crg.es