Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST12299D1BBF1
Clone ID IST12299D1BBF1
Vector VICTR76
Project tigm

Sequence tag IST12299D1BBF1
Sequence
GANNNNNGGGCTNANNNNANNNGNCAGTTATCTGANAANANAGTGGGTAGGGAAAGCTAGACAGNCTGGAANACAGGGAA
TGTGTAAGGCCTGGTCTCATCCAGACAGAGCTATGTGGAACATGGCGGCTGGGGTCCTTAAGTAATACTCTAATGTTTCT
CTGCCTCAATGTCTCTGTCTGTATAATGAAGGGCTTTATCTAAAGCCAGACCACAAATACCATGGCCTATTTAGATCTGT
C
Sequence Type genomic DNA
Unitrap ID UNI30645

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 9: 64783397..64783612 206
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000034452 (Slc24a1) NM_144813 solute carrier family 24 (sodium/potassium/calcium exchanger), member 1 Gene [Source:MGI Symbol;Acc:MGI:2384871]

 
Come back to gene ENSMUSG00000034452


For any suggestions or comments, please send an email to unitrap@crg.es