Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST10218F11HMF1
Clone ID IST10218F11HMF1
Vector VICTR76
Project tigm

Sequence tag IST10218F11HMF1
Sequence
CCNNNCNNCGGGGGTCTNTCACTGGCTTGGAAAANAACNAACTAGGACTAGCAATTGGTTGGGCATGTAAAGGGCTTGCC
CTGCCAGCCTGATGACCTGTATTCAATGCCTGGAATCTGTATAAAGGTGGAAGGAGAGAGCCAAGCNAAGTTGTCTTTTG
CCCNNNNCCTGCACAGTGCACACACAGACGCACATCAATAAACAAAAATAAATGAAAATGAACCAAAAAAGGAANANNGG
GGAGAGGGAAAGAGGGAGAGGAGAGNGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGA
Sequence Type genomic DNA
Unitrap ID UNI17020

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 4: 147480834..147481128 273
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000029005 (2610109H07Rik) NM_027426 RIKEN cDNA 2610109H07 gene Gene [Source:MGI Symbol;Acc:MGI:1917683]

 
Come back to gene ENSMUSG00000029005


For any suggestions or comments, please send an email to unitrap@crg.es