Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone H006D03
Clone ID H006D03
Vector FlipROSAbgeo0
Project ggtc

Sequence tag H006D03
Sequence
GACGGGCGAGGCGGTGAGGGAGCAGCAACAGCGGCGGCGGCTGTAGCGGCGGAGGCTTCGGCGTCGGCGACAGCGACAGC
GACGGGCTCTGGTGACGTCTTCTCTGAGGG
Sequence Type mRNA
Unitrap ID UNI6910

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr X: 155970658..155970767 106
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000044150 (A830080D01Rik) NM_001033472 RIKEN cDNA A830080D01 gene Gene [Source:MGI Symbol;Acc:MGI:2685992]


SPLK-Sequence tag 5SH006D03
Sequence
ATACTCATCTGACACCCTGCGAACCACNNNNCNNNGGTTCCAAGACTTCAATTTGGCT
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser

 
Come back to gene ENSMUSG00000044150


For any suggestions or comments, please send an email to unitrap@crg.es