Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST11823A4HMF2
Clone ID IST11823A4HMF2
Vector VICTR76
Project tigm

Sequence tag IST11823A4HMF2
Sequence
ATTNACNNCCNNNNNNNGNGGGTCTTTCATTACTAATTTAAACTTACAATCTCCCCAAAAATCAAATTCCAGAATTGGGC
GTGTGAAACAGGAGGCTACACGTGGGGGTGCCCATGTAATCCCAGCACCCAGGANATAACTCATGTGGTTTCTCCCTCAT
GTTTGTGCATAGAGCANAGTGCAGTCTCTGGTGAAGCCTGAAGCCTCTAGGTTCATCTGCTAAGGGGTTTTCCGTGCCTT
GGGCAATTGTTAGGTGGCGCAGGGTGGGGCTGGCGAGTTCTTTGAGTATTTTTATTATGTATATGTCATCTCTGCATGTA
TGACTGTGTACCATGTACCTACCTATATCCATGGAGACCGGAAGCAGGCATTANATCCCCTGGAACTGGAGTTATAGAAA
GCCATGAGTCACCCAGGTCCTCANACTTANCAGCAAGCGCCCTTACCACTGAGCCNTCCCACCTGCCCTCACATATGTTT
CTAAACATTGTTGATAGAAAGTGTGGTTCCTTGTGGTCCANAAAAATTTGAGANA
Sequence Type genomic DNA
Unitrap ID UNI663

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 10: 6201477..6201980 490
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000040675 (Mthfd1l) NM_172308 methylenetetrahydrofolate dehydrogenase (NADP+ dependent) 1-like Gene [Source:MGI (curated);Acc:Mthfd1l-003]

 
Come back to gene ENSMUSG00000040675


For any suggestions or comments, please send an email to unitrap@crg.es