Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone H007E02
Clone ID H007E02
Vector FlipROSAbgeo0
Project ggtc

Sequence tag H007E02
Sequence
CCGGNNNCGACCNNNTCCGGTTGGCCAGCACATTGAGCCAGCACATCCACATAAGTTGCCTTTTGACAGAGCTGTGGCCA
TGGCAGCATGGTAGGATCCGTGTCCCGGACCCTGAGGCCAG
Sequence Type mRNA
Unitrap ID UNI471

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 8: 72474552..72474654 101
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000036180 (Gatad2a) NM_145596 GATA zinc finger domain containing 2A Gene [Source:MGI Symbol;Acc:MGI:2384585]


SPLK-Sequence tag 3SH007E02
Sequence
CTTGTCCTTTGCCGGTATCATCTTTTTGACTCCTATNNCTGAATTAGATTCTTTTACTTGGGGTCACTGAGGCAGTATTT
AGAGGGTGTTACTTGGGCTTTCGAGACTGAATTCTTCCAGAAGAGTCCCCACCACTCTGACATTTGGATGTGTGGCAGGA
AGTGGCTTGGGCCCACCCAGGCAAGTCTCAGTGTCTGTTTTGGCTTGGAGAAAACCTGCCTGTCCCAGCATAGCTGTCTT
CTCCCTTATACCTCCCCAGCTATTTGGGACTTGGCTATAAGAGCCTGGCTGTGCTATGCGGTTAGAGCAGACATGGCTTC
TGGGCTCCAGTTGCTGATGGGGAATGACCTGGCCTCTATCTTGGAGGACAACTTTGTGGCGAGAACCTGCAGGAGCCGTG
CAGCAGGGCCTCCGTGCTGTATGGCTGGGCTCCATATCATCCTGGGGCAATGGCACCTTGGTATTGTCCTTCAGGTGTCC
TGTCCTTGGGCGGGCTGCTTCAGAAGGCCTGCTTTCTTCCAGACAGGAAGGGAGACAGGAAATGATGGCCCCTTAAAGCC
CCAGGGCAGATGCTATCCTCAAGGAGTGGTCCCCAGTTGCACCAAACTGTAGTCNTNNNTTNNCNANNGCAGCTTCAGAA
GAGTCTATTTGCTTGGGAAAACCAAATAGAAGGGGAGCAGTCCCCCCTTCCCCCATCCATGCTTAGGAGAGTTTCANAGT
ACACCTAGGGGGGAAATNNTGTTCCCCAAGNAATGNCTCCTCCCTTAANNGCCCATTACCTATCC
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser

 
Come back to gene ENSMUSG00000036180


For any suggestions or comments, please send an email to unitrap@crg.es