Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone H004H06
Clone ID H004H06
Vector FlipROSAbgeo0
Project ggtc

Sequence tag H004H06
Sequence
GGCGCCCAAGACGAGGGGCCTCTGGCAGGCACCTGAG
Sequence Type mRNA
Unitrap ID UNI6723

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 16: 17233787..17233823 37
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000050240 (Hic2) NM_178922 hypermethylated in cancer 2 Gene [Source:MGI Symbol;Acc:MGI:1929869]


SPLK-Sequence tag 5SH004H06
Sequence
GATCTTAGGAAGGAGGATACCTGTAAAGTTAGGCA
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser


SPLK-Sequence tag 3SH004H06
Sequence
ATGGGCTCTTGTNNNGACAGAATTCTTCTAACCCCGGTCCTCGCATTTGTTAATAGAGTTGANNAATGTTGGGACCCCAG
TACTGGGGCATCACTGTGGAGTTGCTTTNNGATTTTTATATAGAGCAGTCTCAGCTAGGAAGGTAGGATATTATTACAAT
AGTGTAGTCAGATGATGTGAGTTGTGTATTATGGAAGAGGTAATAGTAGAAAGCCTACTGCAGTTGAAGCACTTCCTGTG
TCACTTAAGAAGGAACCCTTCACCCCAGCTTCTGGAGATGTTCATTCCTTTGNNTTTCTTGTAAGTTGCCACTCATTGAA
GTCACGGACTAACCTTTCTCTGCATCTGTCTGGACCTTGAGCCACAAAGTGGAGTTGTTGGAGTTGGTTTGTCTCCTGTT
CACACAGCAGGGGGAGAGATGACACTCTCCAGAGACTGAAGCGTGTGGAGCTGTAGTTCTGTGGCAGGGCTGCTT
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser

 
Come back to gene ENSMUSG00000050240


For any suggestions or comments, please send an email to unitrap@crg.es