Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST11555F7BBF1
Clone ID IST11555F7BBF1
Vector VICTR76
Project tigm

Sequence tag IST11555F7BBF1
Sequence
CCNNNNNNNNGGGGNTNNNNNANNGGTCACATATACNCACTTCCCTCTGGCCTGTCCTTGCCTTTTCCTGTTATCCCTGA
CTGAATANTGAATACTTNTTACTTCAATGACCNANCCCCATGTCGTCACCCACCTAGCTCCTCTACATNNGGAAGATGGA
TCTAAGCAGAGATGGAATCTCTCTGTCTCTCTCTCTGTNTGTGTGTGTGTGTGTGTGTGTGTGTGTA
Sequence Type genomic DNA
Unitrap ID UNI10563

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 1: 71696905..71697106 186
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000026193 (Fn1) NM_010233 fibronectin 1 Gene [Source:MGI Symbol;Acc:MGI:95566]

 
Come back to gene ENSMUSG00000026193


For any suggestions or comments, please send an email to unitrap@crg.es