Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST11678H12HMF1
Clone ID IST11678H12HMF1
Vector VICTR76
Project tigm

Sequence tag IST11678H12HMF1
Sequence
CTGGCCTTCCTGTANCCNGCTTTCATANNACAGAGATAGATCCTTTCTCCGAAGAGAAAGAGAAAGAGAGAAAGGAAAAC
AGAAGCAAGCCAGCGAGAAGGAGGTCCACGTGTGTAAGCCCAGCACTTGGAAGGTGGAGGCAGGAAGATCTACAAGTTCA
AGGTCATCCTTGACCACATAGTTAATTTGAGGCCAGCTTGAGCTGCACTGACACCCTGTCTCAAAAGGAAACAAAAAAGC
CCCCCACACACACACACAAAGCAAAAATTTTTAGGTAATATTTTCCCCTAAAACAAAATGGTAATGATCTTTAAAAAAGA
TACTAAAAATATTGGCAGGAAAAGAGGCATTTCACTCACCANAATAGCGTGCTGTATGCTTGCTTACATCCACTCTATGG
TCTTTTAAGCTAACTTTTATACAANNAAAACGTATGTNAAATACACTAACATTTGGTTCCNATATCGCAAAANATTGNAN
GANTGGATAGCANATACGGNCTCTCTAAGTGGGNTGANCNCAGGGGGTGGNNGGTTCTCANNGTGTTNTTAAACTGNTNN
G
Sequence Type genomic DNA
Unitrap ID UNI13419

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 11: 62350791..62351316 485
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000018509 (Prr6) proline-rich polypeptide 6 Gene [Source:MGI (curated);Acc:Prr6-001]

 
Come back to gene ENSMUSG00000018509


For any suggestions or comments, please send an email to unitrap@crg.es