Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone H004D01
Clone ID H004D01
Vector FlipROSAbgeo0
Project ggtc

Sequence tag H004D01
Sequence
GGGGGGCGCTGCCCGTGCAGCCAGAGGATCCAGCACCTCTCTTGGGGCTTCTCCGTCCTCGGCGCTTGGAAGTACGGATC
TTTTTTCTCGGAGAAAAG
Sequence Type mRNA
Unitrap ID UNI10712

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 11: 101413083..101413177 93
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000017146 (Brca1) NM_009764 breast cancer 1 Gene [Source:MGI (curated);Acc:Brca1-001]


SPLK-Sequence tag 3SH004D01
Sequence
GAAAGTTGGCAAGGTAAGCTACTGTATTTAAAAGCCCTTTAATGTAGTTTAATTGCATGTGTTTTTAAATTTGTGTTAAA
AGTTCACTGGAACTGGAAGAAATGGATTTATCTGCCGTCCAAATTCAAGAAGTACAAAATGTCCTTCATGCTATGCAGAA
AATCTTAGAGTGTCCGATCTGGTAAGTCAACAGAAGAGTTTACTCAGCTGGAATTCTTCATGTGGTTACTGTTCATGCAA
ATGAGTAGCAGAGGCTTAAGATAGTAGAGAAAAACACTCTGTATTAAAAGGACTTTGTATTTTTCATCCCTGAAGAGTTT
TAAAAATACAGAAAGGTGGTCTTCACTCTGCCATCCCTCCTCCCTGTCCAGGCAAAGCCTGACTTGATGTGTTCTTCCTC
ATGGCAGGATTCTGGCTTTTTCTCCAGGNNNGGGACAGCCTGATCTCTTAGAATGACTCTCATAAATAGCATCAGAATAA
CAATGGAATGCTTGGGGTTTGTGAGGGCCTCTGTCTACCTTTGACA
Sequence Type genomic DNA
Unitrap ID UNI10712

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 11: 101409984..101410509 520
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000017146 (Brca1) NM_009764 breast cancer 1 Gene [Source:MGI (curated);Acc:Brca1-001]

 
Come back to gene ENSMUSG00000017146


For any suggestions or comments, please send an email to unitrap@crg.es