Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST12034F5HMF1
Clone ID IST12034F5HMF1
Vector VICTR76
Project tigm

Sequence tag IST12034F5HMF1
Sequence
CNNNNNNNGGGGGTNTTTNNAGGGTNTTGCTGTATANCACANATGGANCTGGAACTCACCACAGTACCCATTCTGACCTT
GGCCTTGGCATCTTTGTGGCTCGACCTCTGAAGTGCTAGTGTTATAAGCATGTGCCACTGTGCCTGGTTCATGANTGATT
TAAAAAAAAAACACTTTATTTATTTATTTATTTATTTATTTATTTATTTATTTATTTATTTATTTATTNAA
Sequence Type genomic DNA
Unitrap ID UNI13165

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 14: 55025991..55026198 198
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000000958 (Slc7a7) NM_011405 solute carrier family 7 (cationic amino acid transporter, y+ system), member 7 Gene [Source:MGI Symbol;Acc:MGI:1337120]

 
Come back to gene ENSMUSG00000000958


For any suggestions or comments, please send an email to unitrap@crg.es