Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST12032A2BBF1
Clone ID IST12032A2BBF1
Vector VICTR76
Project tigm

Sequence tag IST12032A2BBF1
Sequence
GTTCCTTGGGAGGGTCTCCTCTGANTGATAAGTAGGAGACAGCTTTCCCTTTAGCCTCTGCTCTCAACTCTGGAGAAGCA
GGGTTCAGATTACATCCCTTAGAGTCCCAGCTTGAGATCTGT
Sequence Type genomic DNA
Unitrap ID UNI30671

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 9: 55318313..55318406 94
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000032314 (Etfa) NM_145615 electron transferring flavoprotein, alpha polypeptide Gene [Source:MGI (curated);Acc:Etfa-001]

 
Come back to gene ENSMUSG00000032314


For any suggestions or comments, please send an email to unitrap@crg.es