Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone H003F08
Clone ID H003F08
Vector FlipROSAbgeo0
Project ggtc

Sequence tag H003F08
Sequence
CTCAGGGGAACGATGGCCACAGAGTCTACAGCCGCTGCTGCCATCGCCGCGGAGCTGGTTTCCGCTGACAAAATTGAAGA
TGCTCCTGCTCCTTCNNNCTCGGCAGATAAAATGGAGAG
Sequence Type mRNA
Unitrap ID UNI1110

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 4: 116295372..116300007 71
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000028693 (Nasp) NM_016777 nuclear autoantigenic sperm protein (histone-binding) Gene [Source:MGI (curated);Acc:Nasp-001]


SPLK-Sequence tag 5SH003F08
Sequence
CATTTAGATCACTTTTATAAAGAAAATTTGCACCTTTAATTTTTTAATTGGCACTAATGTAAACACAGTAGTAGGTAAAC
CTGATTCCCTTCAA
Sequence Type genomic DNA
Unitrap ID UNI11645

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 4: 116294922..116295016 91
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000028693 (Nasp) NM_016777 nuclear autoantigenic sperm protein (histone-binding) Gene [Source:MGI (curated);Acc:Nasp-001]


SPLK-Sequence tag 3SH003F08
Sequence
GTTCCATCTTTCTAAGGAGGGGGCTGACCTCAATGGGTTGGCCCCAAAGGCCAGTCTTGATTCTGGGCTATTCCTCAGTT
GACACTCAGGGGATTTTAGGGTATGTCTAGTTGGCAGTTAAAGCTAACTAACTAGGACACCCAGCAAATGGAATGCTAAG
ATAGGAGTTATTTTGGGT
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser

 
Come back to gene ENSMUSG00000028693


For any suggestions or comments, please send an email to unitrap@crg.es