Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone H002G08
Clone ID H002G08
Vector FlipROSAbgeo0
Project ggtc

Sequence tag H002G08
Sequence
TTGATCGTCGCCCTGNNNTATCATAAGGCAAATGGGTTTTCTGCATCAAAAGACNNNCGTCAAGAAGTCACAGTAATAGA
GTTCCAAGAGGCTATTTTGGCTTGTAAAACCCCAAAGAAGACTACCTCCTCCAGACTGGAGTGGAAGAAGGTGGGACAGG
GGGTCTCCTTGGTCTACTACCAACAGGCTCTCCAAG
Sequence Type mRNA
Unitrap ID UNI10718

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 16: 84774780..84807187 114
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000053062 (Jam2) NM_023844 junction adhesion molecule 2 Gene [Source:MGI (curated);Acc:Jam2-001]


SPLK-Sequence tag 3SH002G08
Sequence
AGTGTGAGATAAGTGAGTAGTGACTGAGACTAAAATACCAGAGTGATGAACACTAGACAGAGCGAAGGAGGTGAGGTCCC
CTGAGCCCTGGGACCATTGCTCGCTTAACACAAAAGGCGATCATTCTGCTGTTCTAGTAAATGAAACTGTTGATAGAAGG
GGAAAAAGAAAAAGGCTGATCTGAGTTTGGT
Sequence Type genomic DNA
Unitrap ID UNI10718

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 16: 84807308..84807499 184
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000053062 (Jam2) NM_023844 junction adhesion molecule 2 Gene [Source:MGI (curated);Acc:Jam2-001]

 
Come back to gene ENSMUSG00000053062


For any suggestions or comments, please send an email to unitrap@crg.es