Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST11945H12HMF2
Clone ID IST11945H12HMF2
Vector VICTR76
Project tigm

Sequence tag IST11945H12HMF2
Sequence
GGGAGGGTCTCCTCTGAGTGATTGNNNNNCNACTTTACCCCGTTACTTATTCACTTTACAAAAACCTATCGCCCCGACTC
CTCAATAAGACTTTCTGGACACTTGTTGGCTGTGGTTCTCTTGCATCTGTTTCCATCCGCTGCTTGGACGAAGCCTCTCA
GGAAACAGTTATGCTATCTNGGCTCCTGTCTCCAAGGTGTANTCAACG
Sequence Type genomic DNA
Unitrap ID UNI18069

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 5: 101228042..101228217 172
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000016833 (Mrps18c) NM_026826 mitochondrial ribosomal protein S18C Gene [Source:MGI (curated);Acc:Mrps18c-002]

 
Come back to gene ENSMUSG00000016833


For any suggestions or comments, please send an email to unitrap@crg.es