Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone DD0421
Clone ID DD0421
Vector pGT1lxrT2
Project sanger

Sequence tag DD0421
Sequence
CAACACGGAGTTTTATCACATACCCACTCACAGTGATGCCAGCAAGAAACGGCTGATTGAGGACACTGAGGACTGGCGCC
CCCGGACTGGAACGACTCAGTCTCGTTCTTTCCGGATCCTTGCCCAGATCACTGGGACTGAGCATCTGACAGAATCTGAA
AATGACAATACGAAGAAGGCAAATAGCACCCAGGAGCCTTCTCAGCAACCGGCGTCATCTGGAGCTTCACCTCTGAGCGC
GTCTGAGGGCCCCGAGAGCCCAGGTTCCAGCAGGCCCGCGGTGGCTGGCCTCCGCTCCGCTGCTGCTTTCAAGCCTGTAG
GATCCACCAGCGTCAAGTCACCTAGCTGGCAGCGTCCAAACCAAGCAG
Sequence Type mRNA
Unitrap ID UNI1282

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 3: 141940781..141967406 183
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000028273 (Pdlim5) NM_019809 PDZ and LIM domain 5 Gene [Source:MGI Symbol;Acc:MGI:1927489]

 
Come back to gene ENSMUSG00000028273


For any suggestions or comments, please send an email to unitrap@crg.es