Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone H001E06
Clone ID H001E06
Vector FlipROSAbgeo0
Project ggtc

Sequence tag H001E06
Sequence
TTCCTCCCACCCCCGANNCCCAGCCNNCNNCGACAGGNNNACTTCCTTCCCNNGNNTTCCANNNCTTACCCGGCTCCCCA
AGAAATTCCAGAGACAAGCAGCGAATTTACAAGACTGTTACCNNNTGTATCAGGGTATTNNNCAGCTCCCCAGCGTCATC
CAGGCTCTGGAGAAATACGAAGGAAGACACCAGGCACTGTTGTTGGCAGTTTTTGTGACTCCTCTTATTGATCTTCGTTC
TGATTTTTCAAAATTTCAAGAAATGATAGAAACAACTTTAGATATGGATCAG
Sequence Type mRNA
Unitrap ID UNI4005

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 17: 88088333..88095944 112
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000024151 (Msh2) NM_008628 mutS homolog 2 (E. coli) Gene [Source:MGI Symbol;Acc:MGI:101816]


SPLK-Sequence tag 5SH001E06
Sequence
GATCTGTGAGGCAACTAGGGAAAGAAGATGGGAATCAGGAAAGGTTATGGGGGCCAGGGTGGCTTCAAAGTAGCTACGGA
TTTCATGGCGGAGTAAAGGAACCAGGCAGACAGGCATGACCAGAAACACTTGAGAAGAATCACCCTACAAGAAGGCAGGG
AAGAAGAGGTGTACAGGAGGGGG
Sequence Type genomic DNA
Unitrap ID UNI4005

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 17: 88097051..88097233 183
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000024151 (Msh2) NM_008628 mutS homolog 2 (E. coli) Gene [Source:MGI Symbol;Acc:MGI:101816]

 
Come back to gene ENSMUSG00000024151


For any suggestions or comments, please send an email to unitrap@crg.es