Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone P056F01
Clone ID P056F01
Vector FlipROSAbetageo
Project ggtc

Sequence tag P056F01
Sequence
GGGGGGAGTCGGGGTCTCTTCAGTCCGTGGCCTGCAGGCAGTAGGAAGCTAGAGTTGGAACTCTGGAGAATGCTGGGCAG
AGACCTGGGTGTGGGCAAAGTTCAATCTCATAGGCATGGTTGCTACCCAACTTTCCAAGGCTTTTTTTCCCNNGGGCCAT
GTACCCTAACTGTGCCCGGTGCGGCAAGATTGTGTACCCCACGGAGAAGGTGAACTGTCTGGATAAGTACTGGCATAAAG
CATGCTTTCACTGCGAGACCTGCAAGATGACCCTGAACATGAAGAACTACAAGGGTTATGAGAAGAAGCCTTACTGCAAT
GC
Sequence Type mRNA
Unitrap ID UNI7764

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 11: 97663235..97668233 130
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000038366 (Lasp1) NM_010688 LIM and SH3 protein 1 Gene [Source:MGI (curated);Acc:Lasp1-001]

 
Come back to gene ENSMUSG00000038366


For any suggestions or comments, please send an email to unitrap@crg.es