Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone P023F01
Clone ID P023F01
Vector rFlpROSAbetageo
Project ggtc

Sequence tag P023F01
Sequence
ACCTTTCTTTTTGAGATTAGAGAGACCACAGAGTCTCTTCATGGAGACATAAGTACTCTGAAAACAACTTTGCTGGAGGG
CTTTGCTGGGGTCGAAGAAGCCAGAGAACAGCACGGAAGAAATCACGACTCTGGGTATCTCCACCTGCTTTATAAAAGAC
CGCTGGATCCCAAGAGCGAGGCCCAGCTCCAGGAAATTCGCCGCCTTCACCAGTACGTGAAATTTGCTGTCCAGGATGTG
AATGACGTCCTAGACTTAGAGTGGGATCGGCATCTGGAGCAGAAGAAGAGACAGAG
Sequence Type mRNA
Unitrap ID UNI3595

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 2: 31858518..31862312 162
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000001855 (Nup214) NM_172268 nucleoporin 214 Gene [Source:MGI (curated);Acc:Nup214-001]

 
Come back to gene ENSMUSG00000001855


For any suggestions or comments, please send an email to unitrap@crg.es