Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone P068H07
Clone ID P068H07
Vector rFlpROSAbetageo
Project ggtc

Sequence tag P068H07
Sequence
CGGAGACTCTTCTGTGTGTGCGAGCGCGGAGGGTGCGTGGTGGTCAATCGCTGCCGCCCTGCGCCCTGCGGAGCTCCAGA
GCTCGAACCCCAGCCCTGGAAACCCAG
Sequence Type mRNA
Unitrap ID UNI7354

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr X: 103222615..103222718 100
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000033792 (Atp7a) NM_009726 ATPase, Cu++ transporting, beta polypeptide Gene [Source:MGI (curated);Acc:Atp7a-002]

 
Come back to gene ENSMUSG00000033792


For any suggestions or comments, please send an email to unitrap@crg.es