Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone DC0817
Clone ID DC0817
Vector pGT1lxr
Project sanger

Sequence tag DC0817
Sequence
CAGTAGTAGTCCAGACTGGCCTGGAACTCATCTTCCTGCCTTTGTTTCCCAAATGCTAGGGTCACAGGTGTCTGAAGGGC
CGCTTCATCCATTGTGCTGATGAGACACCATGCTCACCTGAGTTAGGATATAGGCGGGGCCCCAGAGAACAGCTCACCCA
CATATTATTTCTTCCAGAGCCATTCTCAGGGACCCTAAATCCGGGGCAGTAGCTGGGGGTTACCCCTGCAGTTCATTGGA
GCTGCCACCTTCTCTCTGCAGAGCCTGACAGGTCACACGTCCCCTGTGGAGAGTGTCCGTCTCAACACTCCTGAGGAGCT
CATCGTAGCTGGTTCCCAGTCGGGCTCCATCCGCGTCTGGGACCTGGAAGCTGCTAAAA
Sequence Type mRNA
Unitrap ID UNI1283

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 8: 97613599..97613977 370
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000031787 (Katnb1) NM_028805 katanin p80 (WD40-containing) subunit B 1 Gene [Source:MGI Symbol;Acc:MGI:1921437]

 
Come back to gene ENSMUSG00000031787


For any suggestions or comments, please send an email to unitrap@crg.es