Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone P062B02
Clone ID P062B02
Vector rFlpROSAbetageo
Project ggtc

Sequence tag P062B02
Sequence
AGGAAGGNNNAGTTGTGGGCCAGCTTCCTTAATGNNNTAGGCCCAAAGTCAAAAGCAGCCCCAGGTTCCCANNNTAAGGT
AGCGGAGGAGACNGAAGAGATTAGTTTGAATANNNCGTTGGTCAAAGCAGATGAGCTGGATAAGCCTAGAGAATCAGAAA
AGGTGAAGATTACCAAGGTGTTTGACTTCGCTGGCGAAGAAGTAAGGGTGACTAAGGAAGTAGATGCTGCGTCTAAGGAA
GCGAAGTCTTTCCTCAAGCAAACAGAGAGAGAAAAACCGCAGGCTCTTGTCACTTCACCAGCGACACCACTCCCTGCTGG
GTCAGGGATAAAAAGAGCAAGTGGTATGAGCAGCCTCTTAGGGAAAATTGGAGCCAAAAAACAGAAGATGAGCACCCTTG
AGAAATCCAAACTGGACTGGGAGAGCTTCAAGGAAGAAGAGGGGATTGGTGAAGAACTGGCCATCCATAACCGAGGGAAA
GAAGG
Sequence Type mRNA
Unitrap ID UNI10744

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 8: 114303151..114365750 160
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000031954 (Cfdp1) NM_011801 craniofacial development protein 1 Gene [Source:MGI Symbol;Acc:MGI:1344403]

 
Come back to gene ENSMUSG00000031954


For any suggestions or comments, please send an email to unitrap@crg.es