Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone G024E09
Clone ID G024E09
Vector U3CEO
Project ggtc

Sequence tag G024E09
Sequence
GCGGCTGTGGCGCTCTGCACACGGAAGGAGACAAGGCCTTCGTTGAATTCTTGATTGATGAAATTAAGTAATAAAAGAAG
ATCCAGAAACACAAGTCCC
Sequence Type mRNA
Unitrap ID UNI10749

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 11: 70795751..70796253 68
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000018446 (C1qbp) NM_007573 complement component 1, q subcomponent binding protein Gene [Source:MGI (curated);Acc:C1qbp-001]

 
Come back to gene ENSMUSG00000018446


For any suggestions or comments, please send an email to unitrap@crg.es