Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone P145C08
Clone ID P145C08
Vector FlipROSAbetageo
Project ggtc

Sequence tag P145C08
Sequence
CGCGGCAGCGGGTCTCAAGAGCCGAGCGCTTTGCAAGNNCCTTCGCGGGTTGTGGCGGCGCCGGGGTCGGTGAGGGTCGA
CCGGCTGTGGTCGGGCTGCGGGCGGCTCGGGCAGGTCGCGGGCGCCACAG
Sequence Type mRNA
Unitrap ID UNI10756

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 16: 18289196..18289325 126
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000022718 (Dgcr8) NM_033324 DiGeorge syndrome critical region gene 8 Gene [Source:MGI (curated);Acc:Dgcr8-002]


SPLK-Sequence tag 5SP145C08
Sequence
CAGTGGATTTGGGTTGCTGATGGTAGGAATTTGATTTGCCATCTTGCATGCTTGCATG
Sequence Type genomic DNA
Unitrap ID UNI11042

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 16: 18288641..18288698 58
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000022718 (Dgcr8) NM_033324 DiGeorge syndrome critical region gene 8 Gene [Source:MGI (curated);Acc:Dgcr8-002]


SPLK-Sequence tag 3SP145C08
Sequence
AGAGATGTCCTGTGTTGGGTTGTTGACTCTTGTATGCCAATCACTATTAGGGTGCCCACTCATCTGCTGGCTCAAACTAG
ACTCCCAGCCTTGGAAGTGGCTCAGTTCCCACTGTAATCCATCACTAACCGAAGATAGTGAAAGGCTGGCCCAGCTAGTG
TGGCCTTTCAGTTTAGAATAGGATTTGCGGGGTGACAAAGGAATTGATGAGGTCATACTGCCTTTGGGTTGAGCGGGAGG
CTGCAGCTGTAGCACTGGCCATCCGTTCAGCAAGTAGGAGTTGTTCACATGTTTTGGGTAAGCCCTGTGCCAGGGTCCAG
GGGAGCCAGCAGTGGGTCTGACTTGCTCACAGTCTAATTGGCAAATCAAAATCTGCATCCATAGGTCCAGTCAGCTGAAG
AATAGTGAGGTTTACAGGCAGGAGGGCTACCCTTTGAGCTGTGTTGCCAAACATGTGGAGCAGGCAGCTCACAGTGGCTG
TCTGAATTTTACCTTGTGAGAAACATGATTTTGACTGGTTTGCCCAGTTTGCCCTTCTCTTGTCATCATTCCCCTCCCAT
GTGATCCTATGTACTTTTCACATCNNNTTCCTTTGACATCTTCCATGACTCCCATCTCCAGTACTGTCTGTCCTCCCTTC
TGATCTCCAATCTCCTGCTTCTAGTTGTCTATTCCACTTTAACACC
Sequence Type genomic DNA
Unitrap ID UNI11042

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 16: 18287938..18288622 672
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000022718 (Dgcr8) NM_033324 DiGeorge syndrome critical region gene 8 Gene [Source:MGI (curated);Acc:Dgcr8-002]

 
Come back to gene ENSMUSG00000022718


For any suggestions or comments, please send an email to unitrap@crg.es