Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone P128H10
Clone ID P128H10
Vector FlipROSAbetageo
Project ggtc

Sequence tag P128H10
Sequence
CGTCCACCCGCGAGCACAGCTTCTTTGCAGCTCCTTCGTTGCCGGTCCACACCCGCCACCAG
Sequence Type mRNA
Unitrap ID UNI3488

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 5: 143668331..143668392 62
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000029580 (Actb) NM_007393 actin, beta Gene [Source:MGI Symbol;Acc:MGI:87904]


SPLK-Sequence tag 5SP128H10
Sequence
GCGGACACCTGCACAGCCAACTTTACGCCTAGCGTGTAGACTCTTTGCAGCCACATTCCCGCGGTGTAGACACTCGTGGG
CCGNNNNCCGCTCGGTGCGTGGGGCTTGGGGACACACTAGGGTCGCGGTGTGGGCATTTGATGAACCGGTGCGGCTTGCG
GGTGTTAAAAGCCGTATTAGGTCCATCTAGAGAGTACACAGTATTGGGAACCAGACGCTACGATCACGNNTCAATGGC
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser

 
Come back to gene ENSMUSG00000029580


For any suggestions or comments, please send an email to unitrap@crg.es