Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone P113H02
Clone ID P113H02
Vector FlipROSAbetageo
Project ggtc

Sequence tag P113H02
Sequence
AACGAGCGGCGGCGGCGGCGGGTCCCGAGTCCAACGAGAGCAGCACCG
Sequence Type mRNA
Unitrap ID UNI4705

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 4: 41222073..41222120 46
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000028433 (Ubap2) NM_026872 ubiquitin-associated protein 2 Gene [Source:MGI (curated);Acc:Ubap2-001]

 
Come back to gene ENSMUSG00000028433


For any suggestions or comments, please send an email to unitrap@crg.es