Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST11222A1HMF1
Clone ID IST11222A1HMF1
Vector VICTR76
Project tigm

Sequence tag IST11222A1HMF1
Sequence
TTGACNNNNNNNNNNNGGGGGTNNNNNNNTTCTGCATTGTAGAAAGAGCCCTGCTCANTTTGGCTCTCAGCTCATCCCTT
CCTCNTACATNGTACAAGGTGAAGAAGGGAAGATAGAGATGCAGGAGTTTCTCTAGCATGGCGGCGTGGCACAGAAATGC
TACCACGAATGAGTCTANAGTCATCATTTCCTACCACCGTGTTCCTATGCTTGGTCTGAGTCTGAGGGCTGANAAGTCAC
TTTTATCGGTGTGCTCTTCCTGAGTTTTCTACCTACTTGAATTNNTTNTAGTANTTTCANTGTGACAGAATTCTGTTAGA
CAGCNTGGCTGTCTTCTCTTTCCCTGGGTGGCCTCCAAATATCACACAAATGCTTACACGTTAACG
Sequence Type genomic DNA
Unitrap ID UNI2494

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 17: 53735256..53735610 330
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000000708 (Kat2b) NM_020005 K(lysine) acetyltransferase 2B Gene [Source:MGI Symbol;Acc:MGI:1343094]

 
Come back to gene ENSMUSG00000000708


For any suggestions or comments, please send an email to unitrap@crg.es