Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone P105E07
Clone ID P105E07
Vector ROSAbetageo0
Project ggtc

Sequence tag P105E07
Sequence
TTAATTATTTTNNNNCAACCCCNNACACATTAAAAAAAGAGGGAGGGGGAGGGGACCTCCAGACGCGGAACGTGGTCGCA
GGCTGCAACCTGAGCGAGCTCTCCGGGTTCCCAG
Sequence Type mRNA
Unitrap ID UNI10762

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 13: 49777513..49777572 60
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000037851 (Iars) NM_172015 isoleucine-tRNA synthetase Gene [Source:MGI Symbol;Acc:MGI:2145219]


SPLK-Sequence tag 5SP105E07
Sequence
ATGATGATGATGTCTTAGTCACTTGTTCCTCTGAAGAGACACCCAGAGTGACAATGAAATGCCATTTTTGTGGAACACAG
TACACACATGGTACATGAAACATACATGCAGATAATACCTGTGCACATTAGAGAGATGAATAGTGGATCCCTTTAGCAGA
GTTAAAAGAGACGTCAGGTGTAAAAAGTTAGATGATGATGTATGTCTCTTCCG
Sequence Type genomic DNA
Unitrap ID UNI10762

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 13: 49778793..49779005 207
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000037851 (Iars) NM_172015 isoleucine-tRNA synthetase Gene [Source:MGI Symbol;Acc:MGI:2145219]


SPLK-Sequence tag 3SP105E07
Sequence
ACATAAGCAGCAGCACCCATGGCATTGTGGGATACTTTGTCAAGATAAGTTGAGATCATCTTAAGCAAAGGTTGGTGGAA
ATAGTGTATAAATAGCTAAACGGTCAGGTAAGACT
Sequence Type genomic DNA
Unitrap ID UNI10762

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 13: 49779078..49779192 115
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000037851 (Iars) NM_172015 isoleucine-tRNA synthetase Gene [Source:MGI Symbol;Acc:MGI:2145219]

 
Come back to gene ENSMUSG00000037851


For any suggestions or comments, please send an email to unitrap@crg.es