Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST10118E7BBR1
Clone ID IST10118E7BBR1
Vector VICTR76
Project tigm

Sequence tag IST10118E7BBR1
Sequence
TGCCAAACGCTACAGGTTGGAGTCTTTCAAGGGGACTTGGTGCAGCCAGTGCCCCCTGCTCCCCATGCAGTCTTTTATTT
CTTTTTCTTTTTTTTTCAGTCTTTAATTTATTTATTTTTTGACGCTGGTTTCTGTGTGGCCCTGCTGTCCTGGAACTTTC
TTTGTAAACCAGGCTGGCCTCAAACTCAGAGGTCTACTTGCCTCTGCCTCCTGAGTTTAAATAAAGGTTGATGAGTTCAA
GGCCAGCCTGGGCTATAGGAAACCATGTCTTAAAAAACAAAATGTGGGGCTGCAAAAGGAGCTCAGGAGTTAGGAGCACT
AGCATGGAGTGGGGAGGACTGAAGCATGGATCCG
Sequence Type genomic DNA
Unitrap ID UNI11412

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 8: 109971499..109971822 310
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000031930 (Wwp2) NM_025830 WW domain containing E3 ubiquitin protein ligase 2 Gene [Source:MGI Symbol;Acc:MGI:1914144]

 
Come back to gene ENSMUSG00000031930


For any suggestions or comments, please send an email to unitrap@crg.es