Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST10125D8BBR1
Clone ID IST10125D8BBR1
Vector VICTR76
Project tigm

Sequence tag IST10125D8BBR1
Sequence
AAAAGGCAGGATCTGGGAGTCTTTTAATATACACTGTCAGGTAATGCAGTGCAGACAAGAGCTAGGTCACAGACAAAAGG
AAAGGGGAGTATACTGCAGGGGTCACCGTTATGGAGAAGGACATGATACAGGCAGTGAGAATGATTTTGTTATTTCACAG
ATTGTTATACTACTAGATTAGTAATACTAGACTGATGGACTTTAATTTGGGCAGGTTACCTTGAGCCAATGGGGAATGAA
TTCCCATTTTGGATCTGTATTATGAGATATGTGTAATTATTGGTGACATATTTAAGTGAGCTCAAAAATGTAAAACAAAT
GTCATTAACTGTTGCTGTGTGTATCACATTATAGATCC
Sequence Type genomic DNA
Unitrap ID UNI30717

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 2: 177358897..177359224 316
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000078865 (OTTMUSG00000016574) predicted gene, OTTMUSG00000016574 Gene [Source:MGI Symbol;Acc:MGI:3649838]

 
Come back to gene ENSMUSG00000078865


For any suggestions or comments, please send an email to unitrap@crg.es