Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST10083H1BBR1
Clone ID IST10083H1BBR1
Vector VICTR75
Project tigm

Sequence tag IST10083H1BBR1
Sequence
CAAACTGGGAAAAATATAAACCCCTCCCCTAAAGTGTCTCCTCTGGCATCGCACTCTTTCTGTCTAAAAGAAACACCTGC
CTGTTCCTGCCTTGTGTCTTGATTTTCAGCACCCTTCAGGGTTACGTGATTCAGTCCAAAAGCTTTCTCCGACCTTCCAG
GGGTGCGCTGTCCATCCCCTGATGGTAGTCAGGTTCCTTGTCTTTACTAATACCTACATTTGTGGTCTGCACCTGCTTTT
ACAACTATACTCAATACCTGTGGTGCCCTAAGGATCT
Sequence Type genomic DNA
Unitrap ID UNI30720

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 2: 37308395..37308641 245
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000035437 (Rabgap1) NM_001033960 RAB GTPase activating protein 1 Gene [Source:MGI (curated);Acc:Rabgap1-004]

 
Come back to gene ENSMUSG00000035437


For any suggestions or comments, please send an email to unitrap@crg.es