Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone D001G08
Clone ID D001G08
Vector rFlpROSAbetageo
Project ggtc

Sequence tag D001G08
Sequence
ATGCGCGCTGGGTTGGNNGAAGCGCACGCTGAGGAGCTTCGGCGTCCGGGGTTGGTGTTCCGAGTCTCCTCGTTGCCACT
AAGCAGCACGGCGTGGGACCCTACTTCGGGATTCACACATCCACTTCAG
Sequence Type mRNA
Unitrap ID UNI10195

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 12: 79963039..79963167 125
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000021116 (Eif2s1) NM_026114 eukaryotic translation initiation factor 2, subunit 1 alpha Gene [Source:MGI (curated);Acc:Eif2s1-001]

 
Come back to gene ENSMUSG00000021116


For any suggestions or comments, please send an email to unitrap@crg.es