Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST10017A6BBR1
Clone ID IST10017A6BBR1
Vector VICTR75
Project tigm

Sequence tag IST10017A6BBR1
Sequence
AAAAAAAACCAACAGGTAAAAGACATTAAAAAGTATTTATTCAAAAAGCCCTCAGGCTGGAGAGCCGGGTGGGATCGGCC
GCCTCAATCCTTTCA
Sequence Type genomic DNA
Unitrap ID UNI13863

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 1: 84886765..84886829 63
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000073633 (Fbxo36) NM_025386 F-box protein 36 Gene [Source:MGI (curated);Acc:Fbxo36-001]

 
Come back to gene ENSMUSG00000073633


For any suggestions or comments, please send an email to unitrap@crg.es