Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone D048D06
Clone ID D048D06
Vector rFlpROSAbetageo
Project ggtc

Sequence tag D048D06
Sequence
GATCTCCGGATCCGCCCGCGGCTTTCCTCGGTCAGACCTCGTTAGCTCCGCCCGCCGCGTGCTCCCTCCTCCCACTCGG
Sequence Type mRNA
Unitrap ID UNI10771

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 10: 110357234..110357310 77
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000020186 (Csrp2) NM_007792 cysteine and glycine-rich protein 2 Gene [Source:MGI Symbol;Acc:MGI:1202907]

 
Come back to gene ENSMUSG00000020186


For any suggestions or comments, please send an email to unitrap@crg.es