Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST10013G2BBR1
Clone ID IST10013G2BBR1
Vector VICTR75
Project tigm

Sequence tag IST10013G2BBR1
Sequence
CAACACTAACAGGTTTTGGGTCTTTCACTTGGTTATGAGTTATGTACCTTGTTCTTTGCTTTCTGAAGAACAAAATACCT
TAGTGTGGGGGGAAGCCAAGATGAAAGGAGGGAGAGGGAGAGGGAGAGGGAGCAGCAGGAGGTGGAAAGATTAACTGTTA
CACAACAGAGCTTCCTAGCAAGTCTGGTTGTTTGTTCTGTTGTTTTGAAACAGTCTCTGTACATAGCCCCGTTTCTTCCT
GAAACTCACACCTTATACCAGGCTGTCCTTGAACTCACAGAGATCC
Sequence Type genomic DNA
Unitrap ID UNI30725

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 14: 51565501..51565759 257
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000021871 (Pnp1) NM_013632 purine-nucleoside phosphorylase 1 Gene [Source:MGI (curated);Acc:Pnp1-001]

 
Come back to gene ENSMUSG00000021871


For any suggestions or comments, please send an email to unitrap@crg.es