Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone P132D03
Clone ID P132D03
Vector rFlpROSAbetageo
Project ggtc

Sequence tag P132D03
Sequence
CACCCCNNNCNNNCGAGAGAAGCGAGATTTATTCCTACGTACCGGGCCGTGCTGCTTATGGCGGCGCTGGAGAGGGGGCC
CTGAGCTGTTGGG
Sequence Type mRNA
Unitrap ID UNI7671

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 3: 102824513..102824592 78
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000068823 (Csde1) NM_144901 cold shock domain containing E1, RNA binding Gene [Source:MGI Symbol;Acc:MGI:92356]


SPLK-Sequence tag 5SP132D03
Sequence
AAGGCACTTGTTTTTAAATCCCTTTTACCCAAGCAGGATTTAGAAATCCCCTTTATCTTGCATTAGATGTTTTCCACTTG
AATGTGGTAATAATAATTAAAAACAAACCAATACAAAACTTTAGAAATATT
Sequence Type genomic DNA
Unitrap ID UNI7671

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 3: 102828320..102828450 131
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000068823 (Csde1) NM_144901 cold shock domain containing E1, RNA binding Gene [Source:MGI Symbol;Acc:MGI:92356]


SPLK-Sequence tag 3SP132D03
Sequence
AGCATTAATACAAAGTTGACAATAAATGTCTCTGCTCTTTCCCAACATTGTACAGGTAAAATACCATTGGTTTAAAGCTA
CAGAAAATAAATCGCATTTCTGTTTGTCCAACTTGGTAATTACAAACTCCAGTAAGCAAGCAAGTCTTTGGTGGATATTG
CCTCCTTTTATTAGTTGAAATCTTTGCCTAGTAAACTTACTGTTGCTTTAAAAGACATGTTTTTCCTTCTCAGTTGATGG
CTTATTCTGCAGTGCTTTAGCCACTAAGCTAGGTGTGGCTATTAAACATTGAAAATGTAACTTGAG
Sequence Type genomic DNA
Unitrap ID UNI7671

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 3: 102828475..102828780 304
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000068823 (Csde1) NM_144901 cold shock domain containing E1, RNA binding Gene [Source:MGI Symbol;Acc:MGI:92356]

 
Come back to gene ENSMUSG00000068823


For any suggestions or comments, please send an email to unitrap@crg.es