Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone D046G02
Clone ID D046G02
Vector rFlpROSAbetageo
Project ggtc

Sequence tag D046G02
Sequence
CCNNNNCCCTGTCNNNGCGGTGCAGCAGGTCGGTAGGCGGGAAATGGCGACTGGCTGAAGGAGCTGGTTCTGTTGCTGCT
GAGGGATAAGCGGGAAAGACACCACCTATTGCGCAGTCGGGACCATCGCCGGAGCCCGAAGACACTTTTCTGTCGTCACA
GTGAAG
Sequence Type mRNA
Unitrap ID UNI3860

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 2: 121782194..121782353 154
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000033411 (Ctdspl2) NM_212450 CTD (carboxy-terminal domain, RNA polymerase II, polypeptide A) small phosphatase like 2 Gene [Source:MGI (curated);Acc:Ctdspl2-001]


SPLK-Sequence tag 5SD046G02
Sequence
CTTGAACTTGCTCAGAAAGGATATACTGGACAGGCTTGTAAATAACTGCAGAATCAATTGCTGATTGATAAAGTAGTATT
ATGCTAACTTAATAATAATAATTCGCTATGCTTTTGATTGATAAAATATATAAAGAATATAGTGGTTTGCCAGAATTTGA
AAAGNNNGCAGCATCTCATTTTTTTGTATTTGTAATTTATCAAGTTTTTATGAAAATATAAGGGAGGAAGGAAAGGTACT
TT
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser


SPLK-Sequence tag 3SD046G02
Sequence
GTGTGAAGAGGACTCATACATGGTGCACTCGCTCTTAAGTTGTTTTTACTAGTTAGATTAAAGTTGCCAAACCATTTTAC
ACTGGATTGGCTACAGGAAGTCATTTGTGCTACATTGAAAATGAAGTTGCTTATTTATATACTTG
Sequence Type genomic DNA
Unitrap ID UNI15164

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 2: 121785225..121785370 142
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000033411 (Ctdspl2) NM_212450 CTD (carboxy-terminal domain, RNA polymerase II, polypeptide A) small phosphatase like 2 Gene [Source:MGI (curated);Acc:Ctdspl2-001]

 
Come back to gene ENSMUSG00000033411


For any suggestions or comments, please send an email to unitrap@crg.es