Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST14473B3
Clone ID IST14473B3
Vector VICTR74
Project tigm

Sequence tag IST14473B3HMF2
Sequence
CATGGAGGATCCCCTGAAAAGGAACCAAGTGGGGCCACAAGGTTGCTGGCNAGC
Sequence Type genomic DNA
Unitrap ID UNI30557

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 4: 117084620..117084672 51
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000028677 (Rnf220) NM_025739 ring finger protein 220 Gene [Source:MGI Symbol;Acc:MGI:1913993]


Sequence tag IST14473B3BBF1
Sequence
CATGGAGGATCTGTCGAGGTCGATCGACGGTATCGATTAGTCCNNNNTNNNCTCACAAAAAAGCTATCACATTATACCCT
ATAAATATGATTACTATGTGTCAATTTAAAATAACAATCTAACTCTTTTTAGACAACCTACAGAATGTTTTTTAAAGTCT
CTGTAAATCATTTATCTAATAAGGAATTAACATCCACAATATTAACTTCAACTCAACAAACAGCAAAACAAAACCCTTCA
ATAAAGAAGTAAGCAAAAGGGTGACTTCTAGGACATCCAGGACTACACAGAAAAACTCTGCCCAAAGTACCAGCAAAACC
AAAAATAAAACAAAACAAAAAAGCAAAAGANGCTGGTGAGATGGCTCANTAGGTAAAGGTGCTTGCTNTGAANCCTGACA
ACCTGANTTTGATCCTTGGANCCCANATGGTGGAAA
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr X: 12645968..12646351 370
NO GENE  

 
Come back to gene ENSMUSG00000028677


For any suggestions or comments, please send an email to unitrap@crg.es