Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST13663D3
Clone ID IST13663D3
Vector VICTR74
Project tigm

Sequence tag IST13663D3HMR1
Sequence
AGGATGGAGGGTCCCAAGCTAGCTTGGGGCAAGCTAGTTAGGGGATGGTTCAGAGAGGAGGACTGAGCTGAGTTCGGGGT
GGCTTATGTGCTCAGAATAGCATCTGTTACAGGGCCAAAGGCGGAAAAGAAGACACACCGAAGAGGATGGCAAACCTTTG
AGGAGATACAGGTTGGGTTATTATGAATTTGAGCTCTCTCCCATGTAGACAGCAGACAGATAACCAGTAAGCAGAGGGCA
CCGATATCAGAGGATGGTACATCTAAAGATTCACTAAAGTTGGTACTACATTGATTATTGGGCTTGAAACTCGAGTCATT
GTTGTAAGACATGAT
Sequence Type genomic DNA
Unitrap ID UNI451

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 8: 83328548..83328882 335
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000031714 (Gab1) NM_021356 growth factor receptor bound protein 2-associated protein 1 Gene [Source:MGI Symbol;Acc:MGI:108088]


Sequence tag IST13663D3BBF1
Sequence
NNCNCACGTCCTTCCCAGTCGCATGCTGTTTGGTACTCTTAATCCAAATTACTTGGGGGTTTTGGGAAGCCTTGTCTCTG
TACCTTTCCTCCGCTCCCATCCCCCTGCTCCCCAGGGAGCTTGTATCACCCATTGATGAANAAGCAGGTATGCCCATTGA
AGTTAGGACAATATGGACATCCTCATATGACCTACACATCACAGGGACACTGGTCTGAGCATAACCTGCCTGGCCTACTC
AANAANTGTNNAAANATANCGCTCCATAAATTTTCAACTAACTTGCTTTCNNCCTCTACANANTTGGGAGGTGTCNANGA
ACTTCANTTGAAAANAATTCCGTATAANCACATCTACNCTTAAGCAAATTANNCNANGCTAANCTCAAGGCAGGCCTATC
ACACNTNGGCNANANNNGT
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser

 
Come back to gene ENSMUSG00000031714


For any suggestions or comments, please send an email to unitrap@crg.es