Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST13773F2
Clone ID IST13773F2
Vector VICTR74
Project tigm

Sequence tag IST13773F2BBF1
Sequence
CCGTCTATCAGCAGACCTGGGAGACAGATTCTCTCCTCTGAGTTTCAGTGCTCANAGCACTCTCTGCTGGCAAGCTCTCT
TACAGGGAAGGTGCGCAGATATCTTGTATTTGGACCTCCTCCTGGCCGAANAANAAGGCCCAAAACAGGACCTTTCTCAN
ACACTGTGTTGCTTTGGCAGTTCCCAGGTGGTACAGACTCTCACCTAANCANACTAAATTCCTAAGTTCCTTGGAGTCCC
GGGACCAAGATGGCGACCGCTGCTGCTGTGGCTTAGGCCGCCTCCCCAGCCGGGTGGGCACCTGTCCTCCGGTCCGGAAG
GTGGCCGGCTGTCCCCGGCNNANNCNNGNTN
Sequence Type genomic DNA
Unitrap ID UNI30734 UNI30735 UNI30736

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 18: 43875966..43876304 327
 
EST/CDNA Est Name
  DV075707.1
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 17: 53127671..53128009 327
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 16: 19145543..19145881 327
 
EST/CDNA Est Name
  BI320042.1
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 15: 21805404..21805742 327
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 13: 101818421..101818759 327
 
EST/CDNA Est Name
  CA886748.1 - CJ168023.1 - BY302409.1 - AW320348.1
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 12: 50351902..50352240 327
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 11: 10785035..10785373 327
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 9: 51378467..51378805 327
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 14: 15454304..15454642 327
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 10: 32691532..32691870 327
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 8: 96107038..96107376 327
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 6: 35528021..35528359 327
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 7: 5110504..5110842 327
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 5: 28919846..28920184 327
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 4: 25115203..25115541 327
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 3: 31606036..31606374 327
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr X: 6149213..6149551 327
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000068270 (Shroom4) NM_001040459 shroom family member 4 Gene [Source:MGI (curated);Acc:Shroom4-001]
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 2: 16302614..16302952 327
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000026748 (Plxdc2) NM_026162 plexin domain containing 2 Gene [Source:MGI (curated);Acc:Plxdc2-001]
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 1: 70015083..70015421 327
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000053153 (Spag16) NM_029160 sperm associated antigen 16 Gene [Source:MGI Symbol;Acc:MGI:1913972]


Sequence tag IST13773F2HMF2
Sequence
TTAGGAAGGGAGAGTGCCAGGGCATCATGCATGCTAGGCAAGCACACTACCAACTGAGTGCCATTTTATTCTATGATTGA
TATTTTAAAAACTAAAAACAGAGACGTGTGCTACGCTCTCCGGTCGAGTCAACTGGACAAGCCGAAAGGCTTAAAAGTCA
CTCATGAGGCAAAAGAGTTTCAAGGAAGCTCTCCTGGAGTCTAGTGTTCTCTACCCATACATTAATTTTTCATTCCCGAG
TTCCATTACCGCGCTAGTCTAGAGTATGGATCT
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 17: 45592266..45592535 270
NO GENE  

 
Come back to gene ENSMUSG00000053153


For any suggestions or comments, please send an email to unitrap@crg.es