Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST10760H9
Clone ID IST10760H9
Vector VICTR76
Project tigm

Sequence tag IST10760H9HMR1
Sequence
TTGGTACCCTATTTGCAGTTCAAGGAGATTCACCTTTGCTTCTAGCACATAGCCCAAACCTAATCANATTGGTCATGAAG
ATGCTGTGGTACCCACCTTCCTCAGTAACAGTTC
Sequence Type genomic DNA
Unitrap ID UNI15271

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 2: 20615948..20616059 110
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000036617 (Etl4) NM_001081006 enhancer trap locus 4 Gene [Source:MGI (curated);Acc:Etl4-007]


Sequence tag IST10760H9HMF1
Sequence
CCACTTTTTATATCACAGACTTTTTTTTTTTTTTTTTTTTTTTTN

Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 2: 20615907..20615950 44
NO GENE  

 
Come back to gene ENSMUSG00000036617


For any suggestions or comments, please send an email to unitrap@crg.es