Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST11066B11
Clone ID IST11066B11
Vector VICTR76
Project tigm

Sequence tag IST11066B11BBF1
Sequence
CAAGGACCGGGTACACCAGGGAGGCAGGCTGGGGCTGAAAGAGACTTAGATGGCGAGAGGTTAATGGAGCCAAGACATGA
TTCTGTTCAAGGCCCTCCAGTTTACTCCGGGAGTCTACTTATAAAGGGGAAGGCCCATCCCCCGCCAGTCCACTCTTGGT
GTCTGGAGCCAGCCTGTAGGTGATGTGCAGAATAGGATGTTCCTCCGGAATGTCTCAGGGGCCTCTCNGCAGGTAGCAGT
GTCTTGGANAGAGCAGGTGGCAGAACAAAAGAGCCATCTAGGCCANAANGCTCCTCGTTAGGGTAATTTCCTTCTNAGGG
GCAGCAAGGTCAAAGTCTGGATCAGCCTACTTCAGGGCTGANGGANGCTACAGGCTGCTATGAACATAGTTAAGCAAGTG
TCTTTGTGAGATGTTGAAGCATCTTTTGGGTTATATGCCCAGGANTGGCATGGCTGGGTCTTGAGGTAAAACTATTCCCA
GTTTTCTGANNAACCACCAAATTGATTTCCAAAGNANNNGTACNANNTTNGCACTNCCAGCN
Sequence Type genomic DNA
Unitrap ID UNI30740

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 5: 3943084..3943623 501
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000040407 (Akap9) NM_194462 A kinase (PRKA) anchor protein (yotiao) 9 Gene [Source:MGI (curated);Acc:Akap9-001]


Sequence tag IST11066B11HMF2
Sequence
GGAGTGGGCTCTGGAGCTCTGCTGTGCTGTGTTGTGCTGGCACAGATTGCTGGCACCAGTCACTATAACTTCTTTGTTTA
GGGCTAAAGTTAAAAGATGCCTAGCAGCTTGTATTTAGTCTTTGGTTCCTGGACACAAAGGTGTGTCCTGGTGCTTCATA
GGTCTGTGTTTAATTAAACTCAGGGTCTCTGAAGGTATCCATAATTATGTCATGTTAGAGGGGAGGGAATGAGGCATGGA
TAGGGTATTTCCACTTTGGCTACGTATTTATCAAACTGGGGATAAGGGATTACCATATGGA

Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 8: 126286829..126287128 300
NO GENE  

 
Come back to gene ENSMUSG00000040407


For any suggestions or comments, please send an email to unitrap@crg.es