Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST10118B5
Clone ID IST10118B5
Vector VICTR76
Project tigm

Sequence tag IST10118B5BBF1
Sequence
AGAGAAGAAAAAAGAAGCAAGATGTTGGGGGTGGGGCAGCATTGACCTGATAATAGCTCTAACTTACTTTTCCTATTTAG
AGGATACACACACACACACACACAAGGAGGAACTGATCTGTAATGTGTACTGATTGTATTTTCCCAAACACAGATAGCCT
TGTTAGGTAGAGTGTAAATCCTTATTTTCTAGGTTGGAAACTACTACCAACAAACCCGGGGACTATAGAGTAAGACCCAC
GTCCAGACAGACTGACGAAAGCTTATGTCCTGAATTGCTAATGGTTTTATCCTGACGAGTGTCTGATGGGTTCTGGGGTG
ATGAAAAAAGGGGGCTTGTTTGTCACAGGACAGAAAGAAGCTGCCAGGTGAAGGGCTGGAAAACTGGAGTCAGCTGGATC
ATTGAAAAAATGCTAGTGGCGTCATCAAAAGACGGAATTAAAATTCACGCTGGGAACTCTGATGGAGGGACCCCATATCT
GTTTCCTTGTGGGGGCTGGACTGCTGTTCTTTTAGAAAGCGCTAGAGTATTCTGAAAAGACTCAAAACACTGTTGCTCAC
GTC
Sequence Type genomic DNA
Unitrap ID UNI10652

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 4: 126143774..126144335 529
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000041530 (Eif2c1) NM_153403 eukaryotic translation initiation factor 2C, 1 Gene [Source:MGI (curated);Acc:Eif2c1-001]

 
Come back to gene ENSMUSG00000041530


For any suggestions or comments, please send an email to unitrap@crg.es