Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST14782C11
Clone ID IST14782C11
Vector VICTR76
Project tigm

Sequence tag IST14782C11HMR1
Sequence
GCAGCTTGCAATAGTGCCCCAAGAGCCANAGGGGACAGGCCTCTTCTTGTCAGAAGGCCATTCTTCCTGCCTCTCACAGA
ATTAGCTCATCTCTCCCCGCCCTACGAGAGAGACTTGTGCAAGGCCAGGGCTGCCTGGGGCTCAGCCAGGTGTCTACTTT
CTAAGCCCATCCAAACCAAGAGGCTGAAGGGGATAGGGAGGGGATGAGGGCATCCACCCACGGTAGGAGGC
Sequence Type genomic DNA
Unitrap ID UNI25435

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 14: 26408501..26408730 228
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000007817 (Zmiz1) NM_183208 zinc finger, MIZ-type containing 1 Gene [Source:MGI Symbol;Acc:MGI:3040693]


Sequence tag IST14782C11HMF1
Sequence
CTGCCTGTATAGAGAAACAGCTGAGCCGCCTAGGAGTTGCTTCTGTTCTGAACACCCCTAACAACTCCAATGAGCTCCGA
AGGAATAGAGGGAAGGGTGGGAACACACCCACCTCCTTTGTAGTTGATAGATCTTGTAAGTCAATATTTTGGGACAGTGC
TTATTTTCTGTGCCTAGTGTACTCAAGGGCAGCTTCTGTACCTGACAACTCTAAAACTAACTAACTAACTAACTAACTAA
CTAACTAACTAACTCTCTCTCTCTTTCACACACACGCATACACACACACTTACATGCTTTCTCCCTGTCTCTGCTACCTC
TGTCTCTGTCTCTCTCTCTCACTCTCTCACACACACATTCCTAANNNAATAAAAACAATCTGCTCANTCTATATAGTGCT
ACTTATACAGATGTTTTGAGGGCTGACCNNNNNNTGTTGGACGGNCNTTCNGTATGCTCTTCCTTGGTAAGCTGGTTGGT
GTTTTTN
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 14: 26408019..26408504 460
 
EST/CDNA Est Name
  BE981178.1 - CK341633.1 - BF466033.1


Sequence tag IST14782C11BBF1
Sequence
CTGCCTGTATAGAGAAACAGCTGAGCCNCCNAGGAGTTGCTTCTGTTCTGAACACCCCTAACAACTCCAATGAGCTCCGA
AGGAATAGAGGGAAGGGTGGGAACACACCCACCTCCTTTGTAGTTGATAGATCTG
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 14: 26408371..26408504 130
NO GENE  

 
Come back to gene BE981178.1 - CK341633.1 - BF466033.1


For any suggestions or comments, please send an email to unitrap@crg.es