Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST11643F5
Clone ID IST11643F5
Vector VICTR76
Project tigm

Sequence tag IST11643F5HMR1
Sequence
CAGCTTTGTTTANAATGCTATTACATAGCTCTGGCTGTCATTGAACCTGGCTATGTGTGTAGACCAGGCTGCTCTTGCCT
CTGTGTGTGTGTTTAAATGTGTAAAAGTTGCCTTTTTTAGTTATGACATATTTGGTCCTTTGGAACAAGCAACTTGCCCA
AGGAACTTTTAAAAGGCTATANAANATTAAAAAAAAAAAAAAN
Sequence Type genomic DNA
Unitrap ID UNI10011

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 11: 35586757..35586959 193
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000018846 (Pank3) NM_145962 pantothenate kinase 3 Gene [Source:MGI (curated);Acc:Pank3-001]


Sequence tag IST11643F5BBF1
Sequence
GCTGCATGTTTCTTTCCNATATGAAANCTTTCATTTGTTCACAATGATTTTCTTTTTAAAATCAGGAGAAAATTGACTGA
NAGGAATTTACTCTGCCAATAGCTCAAATTAAAAGAGGGAGGTGGGAGATCTG
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 11: 35586628..35586760 123
NO GENE  

 
Come back to gene ENSMUSG00000018846


For any suggestions or comments, please send an email to unitrap@crg.es