Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST10247E11
Clone ID IST10247E11
Vector VICTR76
Project tigm

Sequence tag IST10247E11BBF1
Sequence
NGNGCNCAGATCTGTCGAGGTCNANCGACGGTNTCCATTAGTCCAATTTANNCCACTAAACAGGGTTTTGCGTATCCCAG
GCTGGCCTTGAAATCACTTCCTAGCTGAGGGTGACCTTTGACCTGGGAACTTCCTGCTTCTGCCTTCCTGGTTCTGCTGC
TCTTAAGTACCATTTCTGATTCCCACGTGCTGTTTAGAGAGTAACTGACTCTCTTGTTGCAGCAGCTGCTGCTGCTGCTG
TTTGAGACAGGTCCCTGTAAACCTGGCTATCTTGGAACTTTAAGACTTGTTCTAGGAAGCCAGACNGGAAATAAGATCTG
Sequence Type genomic DNA
Unitrap ID UNI13061

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 1: 84861353..84861619 265
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000073633 (Fbxo36) NM_025386 F-box protein 36 Gene [Source:MGI (curated);Acc:Fbxo36-001]


Sequence tag IST10247E11HMF2
Sequence
NNTGCNAGTACCTTCTCTGGGTTTTACCCACTGAGCCACTGAGCCACAGGCCCCACTAAACAGGGTTTTGCGTATCCCAG
GCTGGCCTTGAAATCACTTCCTAGCTGAGGGTGACCTTTGACCTGGGAACTTCCTGCTTCTGCCTTCCTGGTTCTGCTGC
TCTTAANTACCATTTCTGATTCCCACGTGCTGTTTAGAGAGTAACTGACTCTCTTGTTGCAGCAGCTGCTGCTGCTGCTG
TTTGAGACAGGTCCCTGTAAACCTGGCTATCTTGGAACTTTAAGACTTGTTCTAGGAAGCCAGACAGGAAATAAGATCTT
GAGTTTGTANATCATCTACAGTTTATGTTACNTATTCCTCTTTCTTAAAACAAAACCNCATTTTCCCGTTTTCCCCTTTA
CATCTTTAGGGTTGGGGAAAGGTTTCATTGGGGAAGTGCTGGA
Sequence Type genomic DNA
Unitrap ID UNI13061

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 1: 84861303..84861742 430
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000073633 (Fbxo36) NM_025386 F-box protein 36 Gene [Source:MGI (curated);Acc:Fbxo36-001]

 
Come back to gene ENSMUSG00000073633


For any suggestions or comments, please send an email to unitrap@crg.es