Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST14635G5
Clone ID IST14635G5
Vector VICTR74
Project tigm

Sequence tag IST14635G5HMR1
Sequence
CANNNNNGTTTGGGTTAATAATTTGGCTGGGCTTGCCCAGANAAATGAGCTCCACCTGCTACTAAGCCCAAACCTAAAAG
GCAGTGGGTCACCACACCTGGCTAGGGATTTTCTTANAAAAGCAGCAAGCCCTGCCTAGCCCCTGATGCTGCCTANATGG
CAGCTCACTTTTCTTCCTGGAGAAAAGACCTGTGCCCTCACAGTGACTAGGTTGGAACATTANAGCGGGGGTGGGGGTGA
AAAAGTGTAATTCTGGATTTGANCCCNNGC
Sequence Type genomic DNA
Unitrap ID UNI6723

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 16: 17251863..17252121 249
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000050240 (Hic2) NM_178922 hypermethylated in cancer 2 Gene [Source:MGI Symbol;Acc:MGI:1929869]


Sequence tag IST14635G5BBF1
Sequence
GATGCTAGCCAGCCACTCCTGGCTCTCTCCCAACACCGTCCTGGAAAGCAATAGGCACTTCAAATGCCAAGAGCCCAGCC
CCCCTCTTGCCACAGTTTCTATGAAATGANNNNNNCAGGTTCTACTAGAAACATAGGTGATGCGATCAGAGGCCAGGAAT
GGCTGCCTCCTCCGTTTCCAACCCTAAGAGCAGCTCTATAGCACATAGAAGAGAATGAATGCACTCCAAGTTTTTTCCAG
TCTATCCTGAAAAGTTTGAGGGCCCTATTAGAGACTTATTGCTGCCTACCTGAAGCTGAGACCTGCCTGGATCT
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 16: 17251547..17251859 301
 
EST/CDNA Est Name
  BY127907.1


Sequence tag IST14635G5HMF1
Sequence
GATGCTAGCCAGCCACTCCTGGCTCTCTCCCAACACCGTCCTGGAAAGCAATAGGCACTTCAAATGCCAAGAGCCCAGCC
CCCCTCTTGCCACAGTTTCTATGAAATGAAATTCTCAGGTTCTACTAGAAACATAGGTGATGCGATCAGAGGCCAGGAAT
GGCTGCCTCCTCCGTTTCCAACCCTAAGAGCAGCTCTATAGCACATAGAAGAGAATGAATGCACTCCAAGTTTTTTCCAG
TCTATCCTGAAAAGTTTGAGGGCCCTATTAGAGACTTATTGCTGCCTACCTGAAGCTGAGACCTGCCTGGATCCAGACTA
CCTGCCCAAGCCTACTAATCCCTAGGCATGTAACCATTTCTATAAGTAACCATCACCATAAGAAAGCACAGAGGGGCCAG
GGCGGTGGTGGCGCACACCTTTAATCCCAGCACTTGAGAGGCAGANGCANGCAGCGGATTTCTGAGTTTGNNNCAGCCTN
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 16: 17251390..17251859 466
 
EST/CDNA Est Name
  BY127907.1

 
Come back to gene BY127907.1


For any suggestions or comments, please send an email to unitrap@crg.es