Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST14421H8
Clone ID IST14421H8
Vector VICTR74
Project tigm

Sequence tag IST14421H8BBF1
Sequence
CTTGGGAGGCAGAGGCAGGCGGATTTCTGAGTTA
Sequence Type genomic DNA
Unitrap ID UNI6941 UNI25103 UNI25259 UNI25975 UNI30750 UNI30751 UNI30752

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 1: 64972206..64972239 34
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000051344 (Plekhm1l) NM_001039493 pleckstrin homology domain containing, family M, member 3 Gene [Source:MGI (curated);Acc:Plekhm1l-001]
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 10: 58012769..58012802 34
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000038010 (Ccdc138) coiled-coil domain containing 138 Gene [Source:MGI Symbol;Acc:MGI:1923388]
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 11: 57704067..57704100 34
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 12: 71193525..71193558 34
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 13: 7498515..7498548 34
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 14: 52727081..52727114 34
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 15: 81148826..81148859 34
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 17: 83396722..83396755 34
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 19: 4189693..4189726 34
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000040247 (Tbc1d10c) NM_178650 TBC1 domain family, member 10c Gene [Source:MGI Symbol;Acc:MGI:1922072]
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 2: 44767937..44767970 34
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 4: 114710376..114710409 34
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000028718 (Stil) NM_009185 Scl/Tal1 interrupting locus Gene [Source:MGI (curated);Acc:Stil-001]
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 5: 92994769..92994802 34
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 6: 53583710..53583743 34
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 7: 35154928..35154961 34
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000066568 (Lsm14a) NM_025948 LSM14 homolog A (SCD6, S. cerevisiae) Gene [Source:MGI (curated);Acc:Lsm14a-001]
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 8: 72463326..72463359 34
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 9: 4471223..4471256 34
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000025892 (Gria4) NM_019691 glutamate receptor, ionotropic, AMPA4 (alpha 4) Gene [Source:MGI Symbol;Acc:MGI:95811]
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr X: 90955251..90955284 34
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000035246 (Pcyt1b) NM_211138 phosphate cytidylyltransferase 1, choline, beta isoform Gene [Source:MGI (curated);Acc:Pcyt1b-003]


Sequence tag IST14421H8HMR1
Sequence
ATTTTTAANAAAGATTTATTATTATAAACTAGTATGCTGTAGCANGGNNTTNNANCTCATTACAGATGGCNGTGAGCCAC
CATGTGGTTGCTGGGACTTGAACTGAGGACCTACNNAANAGCN
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser

 
Come back to gene ENSMUSG00000035246


For any suggestions or comments, please send an email to unitrap@crg.es